1 Project Background

2 Nanopore Sequencing Introduction

Oxford Nanopore Technologies (ONT) sequencing is a single-molecule real-time sequencing technology based on nanopore electrical signals. In this technology, the DNA double helix, under the action of motor proteins, binds and unwinds from the octameric nanopore protein anchored in the biological membrane [1]. Due to the potential difference on both sides of the biological membrane, the unwound single-stranded DNA passes through the nanopore at a certain rate. Owing to the different chemical properties, the passage of different bases through the nanopore causes variations in electrical signals[2]. Through the detection and analysis of these signal changes, real-time sequencing of the sequence is achieved[3].

Fig. 1 nanopore sequencing principle

Fig. 2 nanopore sequencing principle

3 Experimental Workflow

1） Extract high-quality DNA and assess DNA purity, concentration, and integrity；

a）The DNA sample was inspected to identify any abnormal coloration or potential foreign contaminant；

b）Utilize NanoDrop for assessing DNA purity；

c）Utilize Qubit for quantifying the total amount of DNA；

d）The size distribution of DNA fragments was assessed using agarose gel electrophoresis；

2）After the samples passed quality control, the target DNA fragments were screened using magnetic beads；

3）Performing damage repair and end repair on DNA fragments；

4）Utilizing magnetic bead purification for DNA；

5）Using the SQK-LSK114 kit to connect sequencing adapters to the purified products；

6）Utilizing magnetic bead purification for DNA；

7）Using Qubit accurate quantification of constructed DNA libraries；

8）Loading the library onto the R10.4.1 Flow Cell；

9）Perform sequencing on the PromethION sequencer (Oxford Nanopore Technologies, Oxford, UK).

Fig. 3 Workflow of nanopore sequencing experiment

4 Sequencing Data and Quality Control

4.1 Sequencing Data Format

The raw signal data obtained from the sequencing platform undergoes basecalling analysis, which converts it into raw sequencing reads, referred to as Raw Data or Raw Reads. The results are stored in the FASTQ (abbreviated as fq) file format[4].It contains the base information of sequencing reads along with their corresponding sequencing quality information. The Fastq file includes sequence data and associated quality scores. Each read consists of four lines of information, as follows:

Table 1 Example for FASTQ format

@71e8369b-4c46-48e2-9d90-343ab4d0f7b3
GATCTGGTCCTCTCGGACCGCGATTCTTGCCTTCTGTGAACCTCGACAGATCGATCTTGAACCTCGACAGATCGATCTTGAACCTCGA
+
AAFFFAAFFFAAFFFAAFFFAAFFFAAFFFAAFFFAAFFFAAFFFAAFFFAAFFFAAFFFAAFFFAAFFFAAFFFAAFFFAAFFFAAF

Note: The first line starts with “@” and contains the sequence name; the second line is the base sequence, composed of uppercase “A”,“C”,“G”,“T”,“N” where N represents an unknown base; the third line starts with “+”; and the fourth line contains the sequencing quality values corresponding to the sequence, represented in ASCII values, with each letter corresponding to each base in the second line.

During sequencing, an inherent error rate exists. The sequencing quality score quantifies the probability of a base being incorrectly identified. Denoting the sequencing error rate as P and the base quality value as Q_score, the relationship is expressed as:

The per-base sequencing error rate is derived from the quality score (Q_score) through a mathematical transformation. This error rate is calculated during basecalling using a probabilistic model that predicts base misidentification likelihood. The correspondence is shown in the table below:

Table 2 Sequencing Error Rate vs. Quality Score Correspondence Table

Note:Quality score denotes the sequencing quality value;Probability of incorrect basecalling represents the base identification error probability;Base call accuracy indicates the correct base identification rate.

Higher base quality scores correlate with increased basecalling accuracy and reduced sequencing error rates.Q20 signifies 1 misidentified base per 100 bases, which equates to 99% accuracy;Q30 signifies 1 misidentified base per 1,000 bases, which equates to 99.9% accuracy;Q40 signifies 1 misidentified base per 10,000 bases, which equates to 99.99% accuracy.

4.2 Data Filtering Criteria

Since the raw sequencing data may contain low-quality sequences, splice sequences, etc., in order to ensure the reliability of the information analysis results, the raw sequencing data need to be filtered so as to obtain clean reads, which are still stored in the FASTQ format (this sequence file can be directly used for publication, public database submission, etc., and subsequent analysis is based on this data).

Filtering criterion：

1)Removal of read adapters;

2)Filtering out reads with mean Q_score < 9 from sequencing data generated using the R10.4.1 flow cell in HAC mode ();

Filtering out reads with a mean Q_score < 10 from sequencing data generated using the R10.4.1 flow cell in SUP mode ().

4.3 Sequencing Data Statistics

The statistical results of the Nanopore sequencing raw data are as follows:

Table 3 Statistical Information of Nanopore Sequencing Data Volume

Note: Rank represents the data length gradient, where >0 includes all data; Flag represents the data type, where “all” is the total sequencing data, “pass” is the valid sequencing data, and “fail” is the filtered data; TotalBase is the total number of bases; TotalReads is the number of reads; MaxLen is the maximum length of the data; AvgLen is the average length of the data; N50 is the N50 of the data, which is the length of the shortest read at 50% of the total length when all reads are sorted from longest to shortest; L50 is the L50 of the data, which is the number of reads at 50% of the total length when all reads are sorted from longest to shortest; N90 is the N90 of the reads, calculated similarly to N50; L90 is the L90 of the data, calculated similarly to L50; meanQ is the average quality value.

Figure 4 Distribution of Read Lengths and Read Counts in Sequencing Data

Note: The x-axis represents the read lengths, and the y-axis represents the number of reads corresponding to different lengths. The two black vertical lines from left to right represent the average length and N50 of all data, respectively. Different colors correspond to pass reads and fail reads.

Figure 5 Distribution of Read Lengths and Data Volume in Sequencing Data

Note:The x-axis represents the read lengths, and the y-axis represents the data volume corresponding to different lengths. The two black vertical lines from left to right represent the average length and N50 of all data, respectively. Different colors correspond to pass reads and fail reads.

Figure 6 Distribution of Quality Values and Read Counts in Sequencing Data

Note: The x-axis represents the average quality value of each read, and the y-axis represents the number of reads corresponding to different quality values. Different colors correspond to pass reads and fail reads.

5 References

[1] Deamer, David et al. “Three decades of nanopore sequencing.” Nature biotechnology vol. 34,5 (2016): 518-24. doi:10.1038/nbt.3423

[2] Magi, Alberto et al. “Nanopore sequencing data analysis: state of the art, applications and challenges.” Briefings in bioinformatics vol. 19,6 (2018): 1256-1272. doi:10.1093/bib/bbx062

[3] Jain, Miten et al. “The Oxford Nanopore MinION: delivery of nanopore sequencing to the genomics community.” Genome biology vol. 17,1 239. 25 Nov. 2016, doi:10.1186/s13059-016-1103-0

[4] Cock, Peter J A et al. “The Sanger FASTQ file format for sequences with quality scores, and the Solexa/Illumina FASTQ variants.” Nucleic acids research vol. 38,6 (2010): 1767-71. doi:10.1093/nar/gkp1137

6 Appendix

6.1 Ultra-long DNA Extraction Protocol for Plant Samples (SDS method)

1.Prepare sterilized mortars, pestles, scoops, liquid nitrogen containers, and liquid nitrogen.

2.Weigh 0.5 g of fresh plant tissue (adjust as needed based on sample type), freeze with liquid nitrogen, and grind at low temperature for 15–20 minutes. If grinding is incomplete, extend the time appropriately. Transfer the ground tissue into a 50 mL centrifuge tube and resuspend with 30 mL of lysis buffer.

3.Vortex briefly to mix, then place the tube in an ice box and mix on a shaker at low speed for 30 minutes.

4.Filter the lysate through a 100 μm mesh to collect the filtrate.

5.Centrifuge at 5000 × g for 10 minutes; discard the supernatant and retain the pellet.

6.Add another 30 mL of lysis buffer, mix, and shake again at low speed for 10 minutes in an ice box.

7.Centrifuge again at 5000 × g for 10 minutes; discard the supernatant and keep the pellet.

8.Immediately add 5 mL of SDS extraction buffer and 20 μL of RNase A (100 mg/mL). Vortex gently, then incubate at 50°C for 1.5 hours, gently inverting the tube every 20 minutes.

9.Cool the lysate to room temperature, then centrifuge.

10.Centrifuge at 5000 × g for 10 minutes, and transfer the supernatant to a fresh tube.

11.Add an equal volume of phenol:chloroform:isoamyl alcohol (25:24:1) for extraction.

12.Centrifuge at 5000 × g for 10 minutes, transfer the supernatant to a new tube.

13.Add an equal volume of chloroform:isoamyl alcohol (24:1) and repeat extraction.

14.Add 0.8 volumes of pre-chilled isopropanol to the supernatant to precipitate DNA. Gently invert to mix, then centrifuge.

15.Discard the supernatant, wash the pellet twice with pre-cooled 75% ethanol.

16.Air-dry the pellet to remove residual ethanol, then dissolve the DNA in 100 μL of Elution Buffer (EB), and incubate overnight.

Experimental Instruments

Experimental Reagents

6.2 Ultra-long DNA Extraction Protocol for Animal Tissue Samples (SDS method)

1.Prepare sterilized mortars, pestles, scoops, liquid nitrogen containers, and liquid nitrogen.

2.Weigh 0.5 g of fresh animal tissue (adjust as needed based on sample type; use 50-100 mg for internal organs), freeze with liquid nitrogen, and grind at low temperature for 15–20 minutes. If grinding is incomplete, extend the time appropriately. Transfer the ground tissue into a 50 mL centrifuge tube and resuspend with 30 mL of lysis buffer.

3.Vortex briefly to mix, then place the tube in an ice box and mix on a shaker at low speed for 30 minutes.

4.Filter the lysate through a 100 μm mesh to collect the filtrate.

5.Centrifuge at 5000 × g for 10 minutes; discard the supernatant and retain the pellet.

6.Add another 30 mL of lysis buffer, mix, and shake again at low speed for 10 minutes in an ice box.

7.Centrifuge again at 5000 × g for 10 minutes; discard the supernatant and keep the pellet.

8.Immediately add 5 mL of SDS extraction buffer and 20 μL of RNase A (100 mg/mL). Vortex gently, then incubate at 50°C for 1.5 hours, gently inverting the tube every 20 minutes.

9.Cool the lysate to room temperature, then centrifuge.

10.Centrifuge at 5000 × g for 10 minutes, and transfer the supernatant to a fresh tube.

11.Add an equal volume of phenol:chloroform:isoamyl alcohol (25:24:1) for extraction.

12.Centrifuge at 5000 × g for 10 minutes, transfer the supernatant to a new tube.

13.Add an equal volume of chloroform:isoamyl alcohol (24:1) and repeat extraction.

14.Add 0.8 volumes of pre-chilled isopropanol to the supernatant to precipitate DNA. Gently invert to mix, then centrifuge.

15.Discard the supernatant, wash the pellet twice with pre-cooled 75% ethanol.

16.Air-dry the pellet to remove residual ethanol, then dissolve the DNA in 200 μL of Elution Buffer (EB), and incubate overnight.

Experimental Instruments

Experimental Reagents

6.3 Ultra-long DNA Extraction Protocol for Blood (mammal) Samples (SDS method)

1.Gently invert the fresh blood sample several times to ensure thorough mixing. Place the sample on ice for later use.

2.Transfer 1 mL of blood into a centrifuge tube. Add 3 mL of red blood cell (RBC) lysis buffer (blood : RBC lysis buffer = 1:3). Mix well and incubate on ice for 10–15 minutes.

3.Centrifuge at 1300 g, 4 °C for 15 minutes. Discard the supernatant and retain the pellet.

4.Add another 3 mL of RBC lysis buffer, mix gently, and incubate on ice for 5 minutes.

5.Centrifuge at 1300 g, 4 °C for 15 minutes. Discard the supernatant and retain the pellet.

6.Immediately add 5 mL of SDS extraction buffer and 20 μL of RNase (100 mg/mL). Vortex briefly to mix. Incubate at 50 °C for 1.5 hours, inverting the tube gently every 20 minutes.

7.After lysis, cool the lysate to room temperature.

8.Centrifuge at 5000 g for 10 minutes. Transfer the supernatant to a new centrifuge tube.

9.Add an equal volume of phenol : chloroform : isoamyl alcohol (25:24:1). Mix thoroughly for extraction.

10.Centrifuge at 5000 g for 10 minutes. Transfer the supernatant to a new centrifuge tube.

11.Extract again with an equal volume of chloroform : isoamyl alcohol (24:1).

12.Add 0.8 volumes of pre-chilled isopropanol to the supernatant to precipitate DNA. Gently invert to mix, then centrifuge.

13.Discard the supernatant. Wash the DNA pellet with pre-chilled 75% ethanol. Repeat the wash once.

14.Remove residual ethanol and air-dry the DNA pellet. Add 200 μL of EB buffer and incubate overnight to fully dissolve the DNA.

Experimental Instruments

Experimental Reagents

6.4 Ultra-Long Library Construction and Sequencing Workflow for Plant and Animal Samples (Using ONT Kit: SQK-LSK114)

1.Take 5 µg of quality-controlled DNA sample. Perform 0.4× AMPure bead purification. Use 1µl for Qubit quantification.

2.Damage and End Repair:

Incubation: 20°C for 40 min, 65°C for 10 min, store at 4°C.

3.Perform 0.4× AMPure bead purification. Elute with 61 µl EB. Use 1 µl for Qubit quantification.

4.Adapter Ligation:

Incubation: 25°C for 40 min.

5.Perform 0.4× AMPure bead purification. Elute with 25 µl Elution Buffer. Use 1 µl for Qubit quantification.

6.Final Library Preparation:

7.Sequencing:Load library onto an R10.4.1 flow cell. Perform sequencing using a PromethION (Oxford Nanopore Technologies, Oxford, UK) for 48–72 hours.

Experimental Instruments

Experimental Reagents

7 Contact Us

Customer Service Telephone: 1-(617)-223-7544

Customer Service Email:

Company Website: www.sailgene.com

Company Address: One Innovation Drive, Suite B3-406, Worcester, MA 01605, USA